rs6501798 chr17:75448566 C>T
- Sequence
catttatcttctggtgattcataa[C/T]gtccctggctccttagaaaatagt
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | n/a | 2.82 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP alzheimers disease, asthma, barnes akathisia rating scale, chronic kidney disease, circulating a-tocopherol concentrations following 3 y of controlled vitamin e supplementation in men, years of education
GTEx eQTL Adrenal_Gland, Artery_Aorta, Artery_Tibial, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Lung, Nerve_Tibial, Testis, Thyroid, Whole_Blood