rs6501805 chr17:75459847 C>A
- Sequence
tttacgatggtgtctttctttacc[C/A]aaatgataggatttaaaaatattg
- ASB in cell types
- MCF7 WS8 cells breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7 WS8 cells | 1.20 | 0.20 | 1.00 | |||
| breast tumor | n/a | 3.00 | 2.00 |
Items per page:
1 – 2 of 2