rs6502444 chr17:15290043 T>C
- Sequence
ttctcggccgggcgcagtggctca[T/C]gcctgtaatcccagcactttggga
- ASB in cell types
- A549 (lung carcinoma)
- ASB for transcription factors
- JUN_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| JUN_HUMAN | 1.73 | -1.19 | 3.00 | -0.50 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Heart_Atrial_Appendage, Nerve_Tibial