rs6502793 chr17:1574325 A>G
- Sequence
gctggagctggtcggtggcagaga[A/G]tcttgtcctgccttttcttctcaa
- ASB in cell types
- MS-1 (Small cell lung carcinoma) foreskin keratinocyte GM19099 (female B-cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.87 | 1.33 | 1.14 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP college completion, coronary artery disease (cad), diastolic blood pressure (dbp), systolic blood pressure (sbp), variant creutzfeldt-jakob disease, years of education