rs6502987 chr17:6914229 G>A
- Sequence
gcgagtgcagggggccgtgagtgc[G/A]gaagccgcgggtgcaggaacctcg
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) MS-1 (Small cell lung carcinoma) GM19238 (female B-cells lymphoblastoid cell lines) GM18505 (female B-cells Lymphoblastoid Cell Lines)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 2588 (Lymphoblastoid Cell Lines) | n/a | 2.47 | 2.00 | |||
| MS-1 (Small cell lung carcinoma) | 0.66 | -0.64 | 1.00 | |||
| GM19238 (female B-cells lymphoblastoid cell lines) | -0.68 | 0.88 | 1.00 | |||
| GM18505 (female B-cells Lymphoblastoid Cell Lines) | 0.87 | -0.57 | 1.00 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.82 | -0.14 | 1.00 |
Items per page:
1 – 5 of 5