rs6504471 chr17:66917103 A>G
- Sequence
ttctatcttgttgttgtgacacaa[A/G]gggattccattcctataatcatgt
- ASB for transcription factors
- RBM25_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| RBM25_HUMAN | -3.30 | 0.75 | 2.00 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP fasting blood glucose, fasting insulin, homa-ir, late onset alzheimers disease, spine bone mineral density (bmd)