rs6504617 chr17:49607688 T>G
- Sequence
gtgtggatgatcagcctcatttaa[T/G]aagtcaatctgctttacccataat
- ASB in cell types
- iPSC (induced pluripotent stem cells)
- ASB for transcription factors
- DUX4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| DUX4_HUMAN | 2.27 | n/a | 1.00 | -2.51 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP adiponectin levels, biploar disorder (bipolar schizoaffective disorder), total cholesterol, triglycerides