rs6506135 chr18:3790757 T>C
- Sequence
gaaaagggaaggactcatggcttg[T/C]agggaagtggatagtgcatttgtg
- ASB in cell types
- monocyte-derived dendritic cells MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 2.03 | -0.29 | 1.69 | -2.01 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9