rs6508498 chr18:27685986 G>T
- Sequence
ttttttttttccattttttattgg[G/T]cagtggcttatggcacttttggcc
- ASB in cell types
- foreskin keratinocyte glioblastoma cells HCT-116-RAD21-mAC
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | 0.64 | n/a | 2.67 | |||
| glioblastoma cells | -0.42 | 1.33 | 2.00 | |||
| HCT-116-RAD21-mAC | 1.85 | -2.16 | 1.00 |
Items per page:
1 – 3 of 3