rs6508868 chr19:39552612 T>G
- Sequence
gtcacccaggctggtgcaatcatg[T/G]ctcactgcagcttcgacctcctgg
- ASB in cell types
- MDM(monocyte derived macrophages)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MDM(monocyte derived macrophages) | -0.45 | 1.75 | 1.62 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Brain_Frontal_Cortex_BA9, Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Muscularis, Heart_Left_Ventricle, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen, Testis, Thyroid