rs6509035 chr19:42857480 A>T
- Sequence
ggactctgtcgccctctggtggac[A/T]gggagggaagtgtgaacggcagca
- ASB in cell types
- foreskin keratinocyte thoracic aorta
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.04 | 1.69 | 1.80 | -2.57 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
