rs6509981 chr19:56080920 C>T
- Sequence
ttcctgaactgcccttggaagttc[C/T]cctctttcctcgcggctcagcttt
- ASB in cell types
- HEK293 (embryonic kidney) foreskin keratinocyte GM12878 (female B-cells lymphoblastoid cell line) naive IgD+ B cells
- ASB for transcription factors
- ARNT_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ARNT_HUMAN | 1.84 | -1.65 | 1.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP acute lung injury following major trauma, advanced age-related macular degeneration, advanced age-related macular degeneration (choroidal neovascularization) vs. no amd, eye color, late onset alzheimers disease, refractive error, rheumatoid arthritis, triglycerides