rs6510599 chr19:1218220 C>T
- Sequence
gacagactagagggcgctgtgctc[C/T]caccccctaccgccctgagcctgg
- ASB in cell types
- K562 (myelogenous leukemia) MCF7 (Invasive ductal breast carcinoma) THP-1 (acute monocytic leukemia) erythroid progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.92 | 0.11 | 1.97 | |||
| MCF7 (Invasive ductal breast carcinoma) | -0.10 | 1.39 | 1.62 | |||
| THP-1 (acute monocytic leukemia) | 0.37 | 1.19 | 1.00 | |||
| erythroid progenitors | 2.15 | -1.07 | 2.00 |
Items per page:
1 – 4 of 4
Motif analysis
No data available
Genetic associations
GTEx eQTL Esophagus_Mucosa, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Whole_Blood