rs6511284 chr19:9934449 G>T
- Sequence
agtcaccctccaattgcaattctg[G/T]cagcaaactctggcatcctagcca
- ASB in cell types
- HEK293 (embryonic kidney) ovary
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.74 | 0.33 | 1.96 | |||
| ovary | 2.27 | -2.27 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Coronary, Artery_Tibial, Breast_Mammary_Tissue, Colon_Transverse, Nerve_Tibial, Ovary, Skin_Not_Sun_Exposed_Suprapubic, Thyroid, Whole_Blood