rs6512084 chr19:16063143 T>C
- Sequence
cggcaggccaggcacaggggctca[T/C]gcctgtaatcccaatagtttggga
- ASB in cell types
- GM19099 (female B-cells Lymphoblastoid Cell Lines) macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19099 (female B-cells Lymphoblastoid Cell Lines) | 1.97 | -1.69 | 1.00 | |||
| macrophages | 0.06 | 1.55 | 2.00 |
Items per page:
1 – 2 of 2