rs6517167 chr21:33383751 C>T
- Sequence
acttccccaaaaggaaactgtgtc[C/T]ccatcaagcagccacaccctactc
- ASB in cell types
- K562 (myelogenous leukemia) CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| K562 (myelogenous leukemia) | 0.76 | 0.59 | 1.02 | |||
| CTV-1 (Adult T acute lymphoblastic leukemia) | 0.33 | 1.01 | 1.00 |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Muscle_Skeletal, Nerve_Tibial, Pancreas, Pituitary, Thyroid