rs6519398 chr22:22836625 T>C
- Sequence
ccctttgcacattttctaattaga[T/C]tgtcttttgttttgctcttaactg
- ASB in cell types
- macrophages
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| macrophages | 1.97 | -0.27 | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GTEx eQTL Breast_Mammary_Tissue, Colon_Transverse, Esophagus_Mucosa, Lung, Spleen, Stomach, Whole_Blood