rs6529768 chrX:5236288 A>G
- Sequence
acaggttgcatttccaaagcagtt[A/G]cacatgcctcctgtagagggccac
- ASB in cell types
- GM19193 (female B-cells Lymphoblastoid Cell Lines) TTC-1240 (Rhabdoid tumor of the kidney)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM19193 (female B-cells Lymphoblastoid Cell Lines) | 2.51 | -2.35 | 1.00 | |||
| TTC-1240 (Rhabdoid tumor of the kidney) | -1.74 | 2.05 | 1.00 |
Items per page:
1 – 2 of 2