rs6531765 chr4:40228584 A>G
- Sequence
gggttggggatggggggaaccttg[A/G]gatgtgatggttttcttagtcaga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- STAG1_HUMAN SKIL_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | 1.55 | -0.13 | 1.00 | n/a | n/a | |||
| SKIL_HUMAN | 2.42 | -1.96 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP adiponectin levels, amyotrophic lateral sclerosis (als) age of onset, resistance to kuru in aged women despite likely exposure, triglycerides