rs6531868 chr4:75698247 T>C
- Sequence
gtgttaatgttagagagaaggcta[T/C]gtgaggaaggaagcagccagtgaa
- ASB in cell types
- GM02255 (Lymphoblastoid Cell Lines) GM19239 (male B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM02255 (Lymphoblastoid Cell Lines) | -0.59 | 2.23 | 1.00 | |||
| GM19239 (male B-cells lymphoblastoid cell line) | 2.04 | -1.84 | 1.00 |
Items per page:
1 – 2 of 2