rs6533842 chr4:78643241 G>A
- Sequence
acttcctcactggccagacagcag[G/A]tgggcagaaccacaaactcactta
- ASB in cell types
- monocyte-derived dendritic cells
- ASB for transcription factors
- SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.02 | 2.10 | 2.00 | n/a | No Hit |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, comorbid depressive syndrome and alcohol dependence, hypertension (early onset hypertension), premature ovarian failure, serum creatinine
GTEx eQTL Adipose_Visceral_Omentum, Brain_Caudate_basal_ganglia, Brain_Putamen_basal_ganglia, Esophagus_Mucosa, Esophagus_Muscularis, Nerve_Tibial, Pituitary, Thyroid, Whole_Blood