rs6535271 chr4:81688269 G>A
- Sequence
ataaattcagcagcactgatgtga[G/A]gagattggagatctccctctgctg
- ASB in cell types
- VCaP (prostate carcinoma) GM12878 (female B-cells lymphoblastoid cell line) IMR-5 (Neuroblastoma) HMEC (human mammary epithelial cells)
- ASB for transcription factors
- STAG1_HUMAN CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| STAG1_HUMAN | -0.23 | 1.18 | 1.04 | n/a | n/a | |||
| CTCF_HUMAN | 0.81 | 1.21 | 1.29 | n/a | No Hit |
Items per page:
1 – 2 of 2