rs6537307 chr4:144680711 A>G
- Sequence
tggacttcttctaaatgaaacaga[A/G]gaactctatttttacatgttgatg
- ASB in cell types
- CTV-1 (Adult T acute lymphoblastic leukemia)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| CTV-1 (Adult T acute lymphoblastic leukemia) | n/a | 1.96 | 1.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP autism with high iq, birth weight, birth weight and gestational age, height, late onset alzheimers disease, parkinsons disease, primary rhegmatogenous retinal detachment, tetrology of fallot, total cholesterol
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid