rs6537949 chr9:134782015 T>G
- Sequence
ctgggagccacccgtgccctctgc[T/G]gaaggatctgagggcttttgccct
- ASB in cell types
- GM19240 (B cells Lymphoblastoid Cell Lines) GM02610 (Lymphoblastoid Cell Lines) GM19099 (female B-cells Lymphoblastoid Cell Lines) GM12890 (Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.43 | 1.84 | 1.25 | -4.49 | Discordant | |||
| STAG1_HUMAN | 0.73 | 2.70 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
