rs6538083 chr12:87363855 G>C
- Sequence
agttccatagaaaaagcacagttt[G/C]ccccgctgggtggcactctcactc
- ASB in cell types
- 2588 (Lymphoblastoid Cell Lines) GM02255 (Lymphoblastoid Cell Lines) LNCaP C4-2B (prostate carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 0.31 | 2.67 | 1.19 | 1.16 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
