rs6538435 chr12:93564445 T>C
- Sequence
gaaggctgagtccccctagtgggt[T/C]ctacgaggcctggaacattgtaag
- ASB in cell types
- GM17942 (lymphoblastoid cell) GM19238 (female B-cells lymphoblastoid cell lines) GM18486 (Lymphoblastoid Cell Lines) GM18526 (B – cells Lymphoblastoid Cell Lines)
- ASB for transcription factors
- CTCF_HUMAN STAG1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 1.21 | 0.10 | 1.45 | 0.24 | Weak Discordant | |||
| STAG1_HUMAN | 0.91 | 0.27 | 1.07 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
