rs6540119 chr16:87950871 A>T
- Sequence
tggggacccctgaccacttatgtc[A/T]gggaaaacgccaccaagcgctccg
- ASB in cell types
- HEK293 (embryonic kidney) HCT-116 (colon carcinoma) K562 (myelogenous leukemia) A549 (lung carcinoma)
- ASB for transcription factors
- IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -0.52 | 1.56 | 1.50 | 2.91 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
