rs6541331 chr1:230749263 C>T
- Sequence
gccaattgcagtgtgaggtcacgg[C/T]actggcagatcacgtggggttgca
- ASB in cell types
- breast tumor
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | 2.19 | n/a | 2.00 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP age at death with kuru exposure, comorbid depressive syndrome and alcohol dependence, irritible bowel syndrome, ldl cholesterol change with statins, neuroblastoma (brain cancer), partial epilepsy, rheumatoid arthritis, total cholesterol change with statins
GTEx eQTL Adipose_Subcutaneous, Cells_Cultured_fibroblasts, Colon_Transverse, Lung, Skin_Sun_Exposed_Lower_leg, Thyroid