rs6543322 chr2:105600873 G>A
- Sequence
gctggacagggtggccaaacatac[G/A]tattcaacaggttacaggaagaac
- ASB in cell types
- K562 (myelogenous leukemia)
- ASB for transcription factors
- ZN592_HUMAN LMBL2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ZN592_HUMAN | 1.76 | n/a | 2.00 | n/a | n/a | |||
| LMBL2_HUMAN | 1.63 | n/a | 2.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP ldl cholesterol change with statins, prop taste detection threshold, rheumatoid arthritis, serum creatinine, total cholesterol change with statins, transmission distortion