rs6543413 chr2:98234164 A>G
- Sequence
accaggttatgctgacctagacag[A/G]gttatctaggtgagtccagtgtaa
- ASB in cell types
- MCF7 (Invasive ductal breast carcinoma) MDA-MB-134 (invasive lobular breast carcinoma) MCF7L-P(immortalized breast epithelial cell line) breast tumor
- ASB for transcription factors
- ESR1_HUMAN GATA3_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| ESR1_HUMAN | 1.35 | 0.43 | 1.61 | n/a | No Hit | |||
| GATA3_HUMAN | 1.99 | -0.43 | 1.33 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Cerebellum, Cells_Cultured_fibroblasts, Nerve_Tibial, Thyroid