rs6543423 chr2:106587463 C>T
- Sequence
gtcttatttcacttgacgagagtc[C/T]tctgggttcacacactgcccctct
- ASB in cell types
- MCF7L-P(immortalized breast epithelial cell line) ID00014 (lymphoblastoid cell, DiGeorge syndrome)
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| MCF7L-P(immortalized breast epithelial cell line) | 0.31 | 1.75 | 1.00 | |||
| ID00014 (lymphoblastoid cell, DiGeorge syndrome) | 1.73 | -0.71 | 1.00 |
Items per page:
1 – 2 of 2