rs6545469 chr2:55050722 G>A
- Sequence
ggcacttcctctctcttaccggct[G/A]ggattgcgttcaatgggcggggct
- ASB in cell types
- MDM(monocyte derived macrophages) monocyte-derived macrophages from peripheral blood
- ASB for transcription factors
- SPI1_HUMAN BRD4_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPI1_HUMAN | 1.56 | 0.56 | 1.19 | n/a | No Hit | |||
| BRD4_HUMAN | 1.55 | 1.23 | 1.75 | n/a | n/a |
Items per page:
1 – 2 of 2