rs6546061 chr2:64283884 G>A
- Sequence
gtgcaacttcccctcctccgtcag[G/A]tctcagctccaatgttgcttcctt
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line) K562 (myelogenous leukemia)
- ASB for transcription factors
- IKZF1_HUMAN IKZF2_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF1_HUMAN | -1.48 | 1.87 | 1.60 | n/a | No Hit | |||
| IKZF2_HUMAN | -0.55 | 1.55 | 1.00 | n/a | n/a |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Visceral_Omentum, Artery_Aorta, Artery_Tibial, Brain_Amygdala, Brain_Caudate_basal_ganglia, Brain_Cerebellum, Brain_Cortex, Brain_Nucleus_accumbens_basal_ganglia, Colon_Sigmoid, Esophagus_Mucosa, Heart_Left_Ventricle, Nerve_Tibial, Testis, Thyroid, Whole_Blood