rs6546142 chr2:65300309 T>C
- Sequence
gaggccaccacacccaccgtgtgg[T/C]ccctcctccaggccaagctgcagc
- ASB in cell types
- breast tumor MCF7L-P(immortalized breast epithelial cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| breast tumor | n/a | 2.64 | 3.50 | |||
| MCF7L-P(immortalized breast epithelial cell line) | 0.05 | 1.33 | 1.00 |
Items per page:
1 – 2 of 2