rs6546548 chr2:69789890 A>G
- Sequence
atcttcttgcagctgcagacatcc[A/G]cccaagtctgtttttagctcctca
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | -1.50 | 1.64 | 1.25 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, bipolar disorder, college completion, diastolic blood pressure (dbp), hdl cholesterol, mitral annular calcium, resistance to kuru in aged women despite likely exposure, systolic blood pressure (sbp), urinary albumin-to-creatinine ratio
GTEx eQTL Adipose_Subcutaneous, Artery_Tibial, Brain_Anterior_cingulate_cortex_BA24, Brain_Caudate_basal_ganglia, Brain_Cerebellar_Hemisphere, Brain_Cerebellum, Brain_Cortex, Brain_Frontal_Cortex_BA9, Brain_Hippocampus, Cells_Cultured_fibroblasts, Colon_Sigmoid, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Muscle_Skeletal, Nerve_Tibial, Pituitary, Prostate, Testis, Thyroid, Whole_Blood