rs6546642 chr2:25951234 A>G
- Sequence
caatggccgcagctgcacccaagg[A/G]ctaggacatggaaacaggtggaaa
- ASB in cell types
- HEK293 (embryonic kidney) GM02255 (Lymphoblastoid Cell Lines) kidney
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.34 | 0.78 | 1.15 | |||
| GM02255 (Lymphoblastoid Cell Lines) | 0.32 | -0.33 | 1.00 | |||
| kidney | 2.29 | -1.22 | 2.00 |
Items per page:
1 – 3 of 3