rs6547638 chr2:85873888 T>C
- Sequence
cctggtggtaggtccaggtgagga[T/C]gctgactgtgcatgttaaccaagt
- ASB in cell types
- MS-1 (Small cell lung carcinoma) EOL-1 (Acute myeloid leukemia) MCF7L-P(immortalized breast epithelial cell line) HCT-116 (colon carcinoma)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | -0.22 | 1.57 | 1.42 | 2.50 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Artery_Aorta, Artery_Tibial, Brain_Caudate_basal_ganglia, Brain_Spinal_cord_cervical_c-1, Esophagus_Gastroesophageal_Junction, Esophagus_Muscularis, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid, Whole_Blood