rs6548154 chr2:3378347 T>G
- Sequence
gatgggcacctgagctgactccct[T/G]aggttcggcccaaggtgccctaag
- ASB in cell types
- MOLT-4 (Adult T acute lymphoblastic leukemia)
- ASB for transcription factors
- SPT5H_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| SPT5H_HUMAN | 1.52 | 2.60 | 1.25 | n/a | n/a |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP 2 hour glucose, college completion, comorbid depressive syndrome and alcohol dependence, cystatin c in serum, eye color, stabilized warfarin dose, transmission distortion, years of education
GTEx eQTL Adipose_Subcutaneous, Artery_Aorta, Artery_Tibial, Brain_Cerebellar_Hemisphere, Breast_Mammary_Tissue, Cells_Cultured_fibroblasts, Esophagus_Muscularis, Heart_Atrial_Appendage, Heart_Left_Ventricle, Lung, Muscle_Skeletal, Nerve_Tibial, Pituitary, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg