rs6550512 chr3:37946101 T>A
- Sequence
cccttgcctgcggcctcttctcag[T/A]gcaccactgatccgcccaggcatg
- ASB in cell types
- HUVEC-C (HUVEC, umbilical vein endothelial cells)
- ASB for transcription factors
- NOTC1_HUMAN TF65_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| NOTC1_HUMAN | 2.67 | -4.89 | 2.00 | n/a | n/a | |||
| TF65_HUMAN | 1.01 | 0.04 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GTEx eQTL Adipose_Subcutaneous, Adrenal_Gland, Brain_Caudate_basal_ganglia, Brain_Hippocampus, Brain_Putamen_basal_ganglia, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Testis, Thyroid