rs6554148 chr4:54101047 C>T
- Sequence
gagaggacgggcttttagtgtaac[C/T]gtagagtcagccacagaagttcca
- ASB in cell types
- neural progenitors
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neural progenitors | -0.04 | 1.39 | 1.00 |
Items per page:
1 – 1 of 1