rs6555898 chr5:170435150 T>C
- Sequence
acccagggagccggccctggccag[T/C]tgcagccagtaccacctggtgccc
- ASB in cell types
- neutrophils from periferal blood MCF7 (Invasive ductal breast carcinoma) THP-1 (acute monocytic leukemia) HUVEC-C (HUVEC, umbilical vein endothelial cells)
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| neutrophils from periferal blood | -0.01 | 3.31 | 1.50 | |||
| MCF7 (Invasive ductal breast carcinoma) | 1.16 | 0.39 | 2.84 | |||
| THP-1 (acute monocytic leukemia) | 0.74 | 0.92 | 1.00 | |||
| HUVEC-C (HUVEC, umbilical vein endothelial cells) | 1.70 | -1.21 | 1.17 | |||
| ovary | -1.61 | 1.91 | 1.00 |
Items per page:
1 – 5 of 5