rs6556312 chr5:177362718 G>T
- Sequence
ggctgaagggggttcattagtcag[G/T]cccaggtagggttttagccgtaac
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| GM12878 (female B-cells lymphoblastoid cell line) | 1.01 | 0.35 | 1.10 |
Items per page:
1 – 1 of 1
Motif analysis
No data available
Genetic associations
GRASP activated partial thromboplastin time, factor xii antigen, height, irritible bowel syndrome, stabilized warfarin dose, urinary albumin-to-creatinine ratio, waist hip ratio
GTEx eQTL Adipose_Subcutaneous, Adipose_Visceral_Omentum, Artery_Aorta, Artery_Coronary, Artery_Tibial, Cells_Cultured_fibroblasts, Colon_Sigmoid, Colon_Transverse, Esophagus_Muscularis, Heart_Atrial_Appendage, Liver, Muscle_Skeletal, Nerve_Tibial, Skin_Not_Sun_Exposed_Suprapubic, Testis, Thyroid