rs6556651 chr5:163102351 G>A
- Sequence
aaattaactctacagcacctccac[G/A]tgttccttggcagccatgctcttg
- ASB in cell types
- GM02610 (Lymphoblastoid Cell Lines) 2588 (Lymphoblastoid Cell Lines) HUES64 (embryonic stem cells)
- ASB for transcription factors
- CTCF_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (A) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| CTCF_HUMAN | 3.39 | 0.05 | 1.08 | -2.71 | Concordant |
Items per page:
1 – 1 of 1
Motif analysis
