rs6557548 chr6:150631633 A>C
- Sequence
tgcagtaagacttgtaggaaaata[A/C]aagttctaaccttgcatttcagaa
- ASB in cell types
- primary B-CLL cells naive IgD+ B cells
- ASB for transcription factors
- BRD4_HUMAN FOXP1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (A) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| BRD4_HUMAN | -1.55 | 2.32 | 2.00 | n/a | n/a | |||
| FOXP1_HUMAN | -1.61 | 2.66 | 2.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP aortic valve calcium, comorbid depressive syndrome and alcohol dependence, eye color, hdl cholesterol, ldl cholesterol