rs6557939 chr8:26701238 G>C
- Sequence
gtgaatctagctcttaaagttttt[G/C]taagaagcaaaaagtgactatagc
- ASB in cell types
- 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1)) RWPE1 (prostate epithelial cells) CD34+ stem cells-derived erythroblasts
View in PheLiGe Color scale
-log10 FDR of Ref (G) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| 697 (B acute lymphoblastic leukemia with t(1;19)(q23;p13.3) E2A-PBX1 (TCF3-PBX1)) | -0.62 | 2.19 | 1.00 | |||
| RWPE1 (prostate epithelial cells) | -2.08 | 2.45 | 1.00 | |||
| CD34+ stem cells-derived erythroblasts | 2.21 | -1.47 | 2.00 |
Items per page:
1 – 3 of 3