rs6559901 chr9:86084361 C>T
- Sequence
agccacatgttcaagcttggtatc[C/T]ctgataatgaggcacatcgacatc
- ASB in cell types
- CD34+ hematopoietic stem cells-derived proerythroblasts
- ASB for transcription factors
- GATA1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| GATA1_HUMAN | 2.95 | -0.04 | 1.83 | -0.23 | Weak Concordant |
Items per page:
1 – 1 of 1
Motif analysis
Genetic associations
GRASP alzheimers disease, barnes akathisia rating scale, hdl cholesterol, recurrent early onset major depressive disorder, recurrent early onset major depressive disorder (females), simpson-angus scale, triglycerides change with statins
GTEx eQTL Adipose_Visceral_Omentum, Adrenal_Gland, Skin_Not_Sun_Exposed_Suprapubic, Skin_Sun_Exposed_Lower_leg, Thyroid, Whole_Blood