rs6559931 chr9:86500972 C>T
- Sequence
gtctttagcaatgtgaaggtcagg[C/T]gcggttaggggaagtgttctactg
- ASB in cell types
- tibial nerve monocyte-derived dendritic cells
- ASB for transcription factors
- EP300_HUMAN SPI1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (T) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| EP300_HUMAN | 2.50 | -2.18 | 1.00 | n/a | n/a | |||
| SPI1_HUMAN | 1.77 | -0.23 | 1.71 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP asthma, comorbid depressive syndrome and alcohol dependence, height, hypertension (early onset hypertension), resistance to kuru in aged women despite likely exposure, spine bone mineral density (bmd)