rs6562683 chr13:71865356 T>C
- Sequence
caaagtgccctcctcgggtgctgg[T/C]ccgctccctcgcctttcccagcgg
- ASB in cell types
- HEK293 (embryonic kidney) HS-SY-2(Monophasic synovial sarcoma) neural cell
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| HEK293 (embryonic kidney) | 0.44 | 1.13 | 2.58 | |||
| HS-SY-2(Monophasic synovial sarcoma) | 0.56 | 1.36 | 1.70 | |||
| neural cell | 1.32 | 0.28 | 1.00 |
Items per page:
1 – 3 of 3