rs6563416 chr13:84896149 C>G
- Sequence
ctcccgacctcaggtgatccgccc[C/G]cctcggcctcccaaagttctggga
- ASB in cell types
- foreskin keratinocyte gastroesophageal sphincter
View in PheLiGe Color scale
-log10 FDR of Ref (C) ASB
-log10 FDR of Alt (G) ASB
Details
Transcription factors
Cell types
Cell type | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | |
|---|---|---|---|---|---|---|
| foreskin keratinocyte | -1.09 | 1.54 | 2.00 | |||
| gastroesophageal sphincter | 1.66 | -0.74 | 1.00 |
Items per page:
1 – 2 of 2