rs6564101 chr16:85103645 T>C
- Sequence
taacgtctgccgactgtttcagtt[T/C]ctccttgccatgtaggcagcgtga
- ASB in cell types
- GM12878 (female B-cells lymphoblastoid cell line)
- ASB for transcription factors
- IKZF2_HUMAN IKZF1_HUMAN
View in PheLiGe Color scale
-log10 FDR of Ref (T) ASB
-log10 FDR of Alt (C) ASB
Details
Transcription factors
Cell types
Uniprot ID | Effect size Ref | Effect size Alt | FDR Ref | FDR Alt | Mean BAD | Motif fold change | Motif concordance | |
|---|---|---|---|---|---|---|---|---|
| IKZF2_HUMAN | -4.41 | 4.10 | 1.00 | n/a | n/a | |||
| IKZF1_HUMAN | -3.79 | 3.47 | 1.00 | n/a | No Hit |
Items per page:
1 – 2 of 2
Motif analysis
No data available
Genetic associations
GRASP barnes akathisia rating scale, bipolar disorder in alcoholics, chronic kidney disease, irritible bowel syndrome, ldl cholesterol, response to lithium treatment for bipolar disorder, tardive dyskinesia
GTEx eQTL Brain_Cerebellum, Cells_Cultured_fibroblasts, Esophagus_Mucosa, Esophagus_Muscularis, Heart_Atrial_Appendage, Muscle_Skeletal, Skin_Sun_Exposed_Lower_leg, Spleen, Thyroid